• JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
 
  Bookmark and Share
 
 
Tesis Doctoral
DOI
10.11606/T.10.2014.tde-30072014-134946
Documento
Autor
Nombre completo
Marina Vieira de Carvalho
Dirección Electrónica
Instituto/Escuela/Facultad
Área de Conocimiento
Fecha de Defensa
Publicación
Pirassununga, 2014
Director
Tribunal
Silva, Luis Felipe Prada e (Presidente)
Meirelles, Flavio Vieira
Nogueira, Guilherme de Paula
Perecin, Felipe
Pereira, Angélica Simone Cravo
Título en portugués
Produção de leptina recombinante bovina em leveduras Pichia pastoris e avaliação da atividade biológica
Palabras clave en portugués
Pichia pastoris
Bovino
ELISA
Expressão gênica
Leptina Recombinante
Resumen en portugués
No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3' (senso) e 5' - ATTGTCGACGCACCCGGGACTGAGGT - 3' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris.
Título en inglés
Production of recombinant bovine leptin in Pichia pastoris yeasts and evaluation of the biological activity
Palabras clave en inglés
Bovine
ELISA
Gene expression
Pichia pastoris
Recombinant Leptin
Resumen en inglés
In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3' (forward) and 5' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.
 
ADVERTENCIA - La consulta de este documento queda condicionada a la aceptación de las siguientes condiciones de uso:
Este documento es únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro. Esta reserva de derechos afecta tanto los datos del documento como a sus contenidos. En la utilización o cita de partes del documento es obligado indicar el nombre de la persona autora.
Fecha de Publicación
2014-08-25
 
ADVERTENCIA: Aprenda que son los trabajos derivados haciendo clic aquí.
Todos los derechos de la tesis/disertación pertenecen a los autores
Centro de Informática de São Carlos
Biblioteca Digital de Tesis y Disertaciones de la USP. Copyright © 2001-2021. Todos los derechos reservados.