• JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
 
  Bookmark and Share
 
 
Tese de Doutorado
DOI
10.11606/T.10.2014.tde-30072014-134946
Documento
Autor
Nome completo
Marina Vieira de Carvalho
E-mail
Unidade da USP
Área do Conhecimento
Data de Defesa
Imprenta
Pirassununga, 2014
Orientador
Banca examinadora
Silva, Luis Felipe Prada e (Presidente)
Meirelles, Flavio Vieira
Nogueira, Guilherme de Paula
Perecin, Felipe
Pereira, Angélica Simone Cravo
Título em português
Produção de leptina recombinante bovina em leveduras Pichia pastoris e avaliação da atividade biológica
Palavras-chave em português
Pichia pastoris
Bovino
ELISA
Expressão gênica
Leptina Recombinante
Resumo em português
No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3' (senso) e 5' - ATTGTCGACGCACCCGGGACTGAGGT - 3' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris.
Título em inglês
Production of recombinant bovine leptin in Pichia pastoris yeasts and evaluation of the biological activity
Palavras-chave em inglês
Bovine
ELISA
Gene expression
Pichia pastoris
Recombinant Leptin
Resumo em inglês
In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3' (forward) and 5' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.
 
AVISO - A consulta a este documento fica condicionada na aceitação das seguintes condições de uso:
Este trabalho é somente para uso privado de atividades de pesquisa e ensino. Não é autorizada sua reprodução para quaisquer fins lucrativos. Esta reserva de direitos abrange a todos os dados do documento bem como seu conteúdo. Na utilização ou citação de partes do documento é obrigatório mencionar nome da pessoa autora do trabalho.
Data de Publicação
2014-08-25
 
AVISO: Saiba o que são os trabalhos decorrentes clicando aqui.
Todos os direitos da tese/dissertação são de seus autores
Centro de Informática de São Carlos
Biblioteca Digital de Teses e Dissertações da USP. Copyright © 2001-2021. Todos os direitos reservados.