• JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
 
  Bookmark and Share
 
 
Disertación de Maestría
DOI
10.11606/D.11.2017.tde-26042017-131336
Documento
Autor
Nombre completo
Bruna Fernanda Longatti
Dirección Electrónica
Instituto/Escuela/Facultad
Área de Conocimiento
Fecha de Defensa
Publicación
Piracicaba, 2017
Director
Tribunal
Melo, Paulo Cesar Tavares de (Presidente)
Mello, Simone da Costa
Piotto, Fernando Angelo
Sala, Fernando Cesar
Título en portugués
Caracterização agronômica e molecular de linhagens de tomateiro resistentes a tospovírus
Palabras clave en portugués
Gene Sw-5
Melhoramento genético
Tomate
Vira-cabeça do tomateiro
Resumen en portugués
A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5' AATTAGGTTCTTGAAGCCCATCT 3'; R = 5' TTCCGCATCAGCCAATAGTGT 3'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras.
Título en inglés
Agronomic and molecular characterization of advanced breeding tomato lines resistant to tospovirus
Palabras clave en inglés
Solanum lycopersicum
Tomato spotted wilt virus
Breeding program
Gene Sw-5
Tomato
Resumen en inglés
Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.
 
ADVERTENCIA - La consulta de este documento queda condicionada a la aceptación de las siguientes condiciones de uso:
Este documento es únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro. Esta reserva de derechos afecta tanto los datos del documento como a sus contenidos. En la utilización o cita de partes del documento es obligado indicar el nombre de la persona autora.
Fecha de Publicación
2017-05-05
 
ADVERTENCIA: Aprenda que son los trabajos derivados haciendo clic aquí.
Todos los derechos de la tesis/disertación pertenecen a los autores
CeTI-SC/STI
Biblioteca Digital de Tesis y Disertaciones de la USP. Copyright © 2001-2021. Todos los derechos reservados.