• JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
 
  Bookmark and Share
 
 
Disertación de Maestría
DOI
10.11606/D.6.2017.tde-21122016-103103
Documento
Autor
Nombre completo
Ana Tereza Galvani
Dirección Electrónica
Instituto/Escuela/Facultad
Área de Conocimiento
Fecha de Defensa
Publicación
São Paulo, 2016
Director
Tribunal
Razzolini, Maria Tereza Pepe (Presidente)
Ekman, Luciana Regina Meireles Jaguaribe
Sato, Maria Inês Zanoli
Título en portugués
Quantificação  de oocistos de Toxoplasma gondii em amostras de águas superficiais no Estado de São Paulo
Palabras clave en portugués
Água
DNA
Oocistos
qPCR
Toxoplasma gondii
Resumen en portugués
Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo.
Título en inglés
Quantification of Toxoplasma gondii oocysts in surface water samples in São Paulo
Palabras clave en inglés
DNA
Oocysts
qPCR
Toxoplasma gondii
Water
Resumen en inglés
Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5' TAGTATCGTGCGGCAATGTG 3' (531-551) and 5'GGCAGCGTCTCTTCCTCTTTT 3' (571-592) were used. The probe employed was 5 '(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.
 
ADVERTENCIA - La consulta de este documento queda condicionada a la aceptación de las siguientes condiciones de uso:
Este documento es únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro. Esta reserva de derechos afecta tanto los datos del documento como a sus contenidos. En la utilización o cita de partes del documento es obligado indicar el nombre de la persona autora.
AnaTerezaGalvani.pdf (2.13 Mbytes)
Fecha de Publicación
2017-01-23
 
ADVERTENCIA: Aprenda que son los trabajos derivados haciendo clic aquí.
Todos los derechos de la tesis/disertación pertenecen a los autores
CeTI-SC/STI
Biblioteca Digital de Tesis y Disertaciones de la USP. Copyright © 2001-2021. Todos los derechos reservados.